Skip to content

PennChopMicrobiomeProgram/primertrim

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

86 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Primer trim

Tests Codacy Badge codecov DockerHub

Detect short primer sequences in FASTQ reads and trim the reads accordingly.

Installation

Primertrim requires vsearch, our recommended method of installation is through conda and is shown here:

git clone https://github.com/PennChopMicrobiomeProgram/primertrim.git
cd primertrim
conda env create -f primertrim_env.yml -n primertrim 
conda activate primertrim
conda install -c conda-forge -c bioconda vsearch
pip install .

We also have a docker image available on DockerHub:

docker run --rm -it chopmicrobiome/primertrim:latest ptrim -h

Algorithm

Primer detection proceeds in three stages: complete matching, partial matching and (optionally) matching by alignment.

In the complete matching stage, we look for the complete primer sequence in each read. This stage is implemented in Python, and is meant to clear out the "easy" matches before the alignment stage. The user can specify how many mismatches we allow (1 by default). The algorithm used to detect mismatches starts to get slow for more than 2 mismatches, therefore 3 is the maximum number of mismatches allowed in this stage.

In the partial matching stage, we try to detect the primer sequence if it is hanging off the end of the read. The user can specify the minimum length to signify detection of the partial primer sequence (8 base pairs by default).

For the complete and partial matching stages, the user can specify whether we search for the reverse complement (yes, by default).

Optionally, the program proceeds to a third stage of matching by alignment. Here, we use the vsearch aligner to detect primer sequences by semi-global alignment. In this stage, we always search for the reverse complement. If the user provides an alignment directory, the alignment files are kept for inspection or debugging. The vsearch program must be installed for the alignment stage to work.

Example

ptrim GCATCGATGAAGAACGCAGC -i sample.fastq -o sample_trimmed.fastq \
    --log sample_trimmed.log --alignment

About

Trim primers from reads

Resources

Stars

Watchers

Forks

Packages

No packages published

Contributors 4

  •  
  •  
  •  
  •