(en)Japanese ver is here.
(ja)この解説の日本語版はここにあります。
This is a package for nucleic acid analysis support. This package is made for scientists.
NucleotideSequence gene = NucleotideSequence("attgac");
NucleotideSequence templateDNA = gene.complemented(EnumNucleotideSequenceType.dna);
// Transcription
NucleotideSequence mRNA = gene.converted(EnumNucleotideSequenceType.rna);
NucleotideSequence tRNA = mRNA.complemented(EnumNucleotideSequenceType.rna);
// Translation
AminoAcidSequence peptide = AminoAcidSequence(mRNA);
// Translation(direct)
AminoAcidSequence peptideFromDNA = AminoAcidSequence(gene);
// Extension
// attgacattgac
NucleotideSequence gene2 = gene + gene;
// attgaccagtta
NucleotideSequence gene3 = gene + gene.reversed();
// attgacattgac
gene.add(gene.reversed(), useDirection: true);
// Copy
NucleotideSequence geneCopy = gene.deepCopy();
// Get sub sequence
NucleotideSequence gac = NucleotideSequence("attgac").subSeq(3); // FASTA
String fastaContent = '>sequence1\n';
String seq1 = 'ATGCAGTAGCTAGCTACGT';
fastaContent += "$seq1\n";
fastaContent += '>sequence2\n';
String seq2 = 'CGTAGCTAGCTAGCATCGT';
fastaContent += "$seq2\n";
List<NucleotideSequence> nSeq = UtilFasta.read(fastaContent);
String reConvertFasta = UtilFasta.write(nSeq[0], "sequence1"); // Search ecoRI position
final NucleotideSequence seq =
NucleotideSequence('ATGAATTCAGAATTCTATATATATATACC'.toLowerCase());
final NucleotideSequence ecoRI = NucleotideSequence('GAATTC'.toLowerCase());
// get 2 and 9.
List<int> ecoRIPositions = UtilNucleotideSearch.getPositions(seq, ecoRI, true);
// A fuzzy search is also possible.
final NucleotideSequence fuzzyEcoRI = NucleotideSequence('GNMTTC'.toLowerCase());
// get 2 and 9.
List<int> ecoRIPositions2 = UtilNucleotideSearch.getPositions(seq, fuzzyEcoRI, true, fuzzyComp: true);
// Searching for tandem repeats
// get tRepeat[0][0] = 15 (start position), tRepeat[0][1] = 27 (end position).
List<List<int>> tRepeats = UtilNucleotideSearch.tandemRepeat(seq, 2, 2, true);
// A similar API is available for AminoAcidSequence.
AminoAcidSequence aaSeq = AminoAcidSequence.fromStr("MVWWLALALAANYY");
AminoAcidSequence target = AminoAcidSequence.fromStr("LXLXLXXN");
// get tPositions[0] == 4.
List<int> tPositions = UtilAminoAcidSearch.getPositions(aaSeq, target, true, fuzzyComp: true);The basic data structure in this package is as follows.
-
NucleotideSequence
- sequence: List
- nucleotide: Nucleotide
- base: EnumBase, The type of base.
- infoKey: String?, nucleotideInfo key that can be used when considering chemical modification.
- nucleotide: Nucleotide
- type: EnumNucleotideSequenceType, DNA or RNA.
- direction: EnumNucleotideSequenceDirection, The direction of sequence。
- id: String?, The serial ID of this sequence。
- description: String?, The description of this sequence。
- info: Map<String, dynamic>?, The other data of this sequence。
- nucleotideInfo: Map<String, NucleotideInfo>?, Reference for detailed information about the nucleotides in this sequence.
- key: String, A reference key that a Nucleotide has. For example, aliases when chemically decorated.
- value: NucleotideInfo, Information such as chemical modification of Nucleotide.
- sequence: List
-
AminoAcidSequence
- sequence: List
- nucleotide: AminoAcid
- type: EnumAminoAcid, The type of amino acid。
- infoKey: String?, aminoAcidInfo key that can be used when considering chemical modification.
- nucleotide: AminoAcid
- direction: EnumAminoAcidSequenceDirection, The direction of sequence。
- id: String?, The serial ID of this sequence。
- description: String?, The description of this sequence。
- info: Map<String, dynamic>?, The other data of this sequence。
- aminoAcidInfo: Map<String, NucleotideInfo>?, Reference for detailed information about the AminoAcids in this sequence.
- key: String, A reference key that a AminoAcid has. For example, aliases when chemically decorated.
- value: AminoAcidInfo, Information such as chemical modification of AminoAcid.
- sequence: List
If you need paid support for any reason, please contact my company.
This package is developed by me personally, but may be supported via the company.
SimpleAppli Inc.
The C part will be changed at the time of version upgrade.
However, versions less than 1.0.0 may change the file structure regardless of the following rules.
- Changes such as adding variables, structure change that cause problems when reading previous files.
- C.X.X
- Adding methods, etc.
- X.C.X
- Minor changes and bug fixes.
- X.X.C
This software is released under the MIT License, see LICENSE file.
The “Dart” name and “Flutter” name are trademarks of Google LLC.
*The developer of this package is not Google LLC.