Browser-only JavaScript port of vaRRI
Visualise RNA–RNA interactions directly in the browser — no server, no command-line tools required.
Upstream version: Based on the vaRRI Python source as of June 2026 (commit history at BackofenLab/vaRRI).
This port does not include the RNAfold/RNAplfold structure-prediction steps, which require external command-line tools.
Warning
AI-Generated Code Disclaimer: The source code of this project was generated by an AI and may contain errors or inaccuracies. It is recommended to review and test the code thoroughly before using it in a production environment.
- Overview
- Project Structure
- Quick Start
- Input Website
- JavaScript Library API
- Input Format Reference
- License
vaRRI-js is a pure JavaScript rewrite of the Python vaRRI toolkit. It takes RNA secondary-structure and sequence strings in dot-bracket notation, renders them with the Fornac library, and then applies all of vaRRI's post-processing (coloring, highlighting, index labeling, G-U basepair display, …).
What is excluded compared to the original Python vaRRI:
| Python feature | Status |
|---|---|
| RNAfold structure prediction | ✗ excluded (requires CLI tool) |
| RNAplfold accessibility prediction | ✗ excluded (requires CLI tool) |
| Playwright/headless-browser rendering | ✗ excluded — replaced by live browser DOM |
| FASTA file parsing from disk | ✗ excluded — use textarea input instead |
| PNG/SVG file output from CLI | ✓ replaced by in-browser download buttons |
vaRRI-js/
├── index.html # Input website
├── src/
│ ├── README.md # JavaScript library documentation
│ └── vaRRI.js # JavaScript library (main file)
├── fornac/
│ ├── d3.js # D3.js v4 (vendored from upstream vaRRI)
│ ├── fornac.js # Fornac library
│ └── fornac.css # Fornac styles
└── README.md
Clone the repository and open index.html directly in a browser — no build
step or server needed:
git clone https://github.com/BackofenLab/vaRRI-js.git
cd vaRRI-js
# simply open index.html in your browser, e.g.:
open index.html # macOS
xdg-open index.html # Linux
start index.html # WindowsTo use the library in your own HTML page, include the dependencies in the following order:
<link rel="stylesheet" href="fornac/fornac.css" />
<script src="fornac/d3.js"></script>
<script src="fornac/fornac.js"></script>
<script src="src/vaRRI.js"></script>NOTE: The repository does not track node_modules/. If you want to run tests locally, create
it after cloning using:
npm install
npm test- Open
index.htmlin a modern browser (Chrome, Firefox, Edge, Safari). - The page loads with a pre-filled 2-molecule example automatically.
- Fill in or modify the fields in the left panel:
| Field | Description |
|---|---|
| Structure | Dot-bracket structure string. Separate two molecules with &. |
| Sequence | RNA sequence (IUPAC characters). Separate two molecules with &. |
| Start index mol. 1/2 | The number assigned to the first nucleotide of each molecule. Defaults to 1. 0 is not valid; negative offsets are supported. |
| Label interval | Display an index label every N nucleotides. Default: 10. |
| Coloring | strand — mol. 1 in light blue, mol. 2 in golden yellow. loop — Fornac default base-type coloring. |
| Highlighting | region — highlight the entire intermolecular region. basepairs — highlight only the basepair nucleotides. nothing — no highlighting. |
| Background highlighting | basepairs — translucent red polygon around basepair stacks. region — translucent red polygon over the whole region. nothing — disabled. |
| G-U basepairs as dashed lines | When checked, G-U basepairs are drawn with a dashed stroke. |
| Highlight subseq 1/2 | Comma-separated start-end ranges (using the same index space as Start index). Example: 3-8 or 3-8,15-20. |
- Changing selects and checkboxes rerenders immediately. Typed fields rerender when you commit the edit by leaving the field, and single-line inputs also rerender when you press Enter.
Three built-in examples can be loaded with the buttons at the top of the panel:
| Button | Description |
|---|---|
| 2-molecule example | A two-strand RNA-RNA interaction. Demonstrates strand coloring, region highlighting, and background basepair highlighting. |
| 1-molecule example | A single RNA hairpin with Fornac default (loop) coloring. |
| Pseudoknot | A structure containing square-bracket pseudoknot notation […]. |
- Rotation: Click and drag the structure to rotate it for better visualization. Use the mouse wheel or trackpad to zoom in and out.
- Color Pickers: Customize the colors for strands, loops, and highlights using the color pickers in the settings panel.
- Cropping: Use the slider to crop unpaired nucleotides from the ends of the structure. Cropping is applied to both molecules and can be used to focus on the interaction region.
After rendering, use the buttons in the export bar below the visualisation:
| Button | Description |
|---|---|
| ⬇ SVG | Downloads a self-contained SVG file with embedded Fornac CSS. |
| ⬇ PNG | Rasterises the SVG to a canvas (2× resolution) and downloads a PNG. |
Include src/vaRRI.js after the Fornac dependencies. The library exposes a
single global object vaRRI with the a set of respective functions.
The src directory provides a detailed vaRRI-js Library API documentation
vaRRI-js accepts standard dot-bracket notation with the following characters:
| Character | Meaning |
|---|---|
. |
Unpaired nucleotide |
( ) |
Watson-Crick basepair (standard) |
[ ] |
Pseudoknot basepair (square brackets) |
{ } |
Pseudoknot basepair (curly brackets) |
< > |
Intramolecular predicted basepair |
& |
Separator between two molecules |
Separate structures and sequences of two RNA molecules with &:
Structure: ..((((...))))...((...((...((..&............))...))...))..
Sequence: ACGAUCAGAGAUCAGAGCAUACGACAGCAG&ACGAAAAAAAGAGCAUACGACAGCAG
The character positions before & belong to molecule 1; positions after &
belong to molecule 2. Intermolecular basepairs are identified automatically
as unmatched brackets: an opening bracket in molecule 1 that has no partner in
molecule 1 is paired to a closing bracket in molecule 2 (and vice-versa).
Accepted characters (case-insensitive):
| Character(s) | Meaning |
|---|---|
A C G U T |
Standard nucleotides |
R |
A or G |
Y |
C or T/U |
S |
G or C |
W |
A or T/U |
K |
G or T/U |
M |
A or C |
B |
C, G or T/U |
D |
A, G or T/U |
H |
A, C or T/U |
V |
A, C or G |
N |
Any nucleotide |
Molecule positions are displayed using a 1-based index by default. You can change the start index to any integer except 0. Negative start indices are supported (useful when the visualised region is an excerpt of a longer sequence).
This project is a port of vaRRI. See LICENSE for the licence terms.
The bundled Fornac library (fornac/) is © 2014 Peter Kerpedjiev and is
distributed under its own licence.